Стеллажи, телефон (495) 642 02 91
Проектирование, продажа, монтаж лестниц и стеллажей. Стеллажи из различных материалов, простой конструкции и функционального дизайна, обеспечивающее безопасность хранения и удобство доступа.

Стеллажи всех видов

 

Растворитель р 4 аналоги чем заменить


Какие аналоги имеет растворитель Р4 – ООО ДХЗ

Для выполнения малярных работ самого различного типа очень важное значение имеют такие вещества как растворители. Они необходимы для подготовки окрашиваемой поверхности и придания нужной консистенции лакокрасочному материалу. В данной статье будет рассмотрен один из наиболее популярных многокомпонентных растворителей, а именно растворитель Р4.

  Многокомпонентный растворитель марки Р4представляет собой белую прозрачную жидкость, иногда она может иметь желтый оттенок, без наличия видимых взвешенных частиц. Данный разбавитель характеризуется специфическим резким запахом и очень высокими показателями летучести. Средний показатель относительной плотности растворителя Р4 – 0,85 г на куб. см. Температура воспламенения вещества составляет 550 градусов по Цельсию. Производство выполняется согласно стандарту ГОСТ 7827-74.

Растворитель Р 4 – состав, применение и аналоги.

Выше указанный гост распространяется не только на Р-4 растворитель, но и на такие марки как Р-4А, Р-12, Р-5, Р-5А. Все эти растворители представляют собой смесь органических летучих растворителей: кетонов, сложных эфиров, ароматических углеводородов. Основным их назначением считается разбавление перхлорвиниловых и иных ЛКМ.

Растворитель Р-4 предназначен для быстрого и эффективного разбавления ЛКМ на основе поливинилхлоридных хлорированных смол ПСХ ЛН и ПСХ ЛС, эпоксидных смол, сополимеров винилхлорида и иных пленкообразующих веществ (кроме серой и защитной эмали ХВ-124). Он состоит из 62% толуола, 26% ацетона и 12% бутилацетата. Одна из его разновидностей, растворитель Р-4А используется для разбавления ОКМ выполненных на таких же основах, как и в случае с Р-4. Однако у этого растворителя есть одна очень важная особенность – его можно применять для разбавления эмалей ХВ-124.

Одним из наиболее распространенных аналогов Р4 состава считается растворитель марки Р-5, который используют для растворения лакокрасочных материалов, изготовленных на основе каучуков, кремнийорганических, полиакриловых, эпоксидных смол, а также смол ПСХ ЛН и ЛС. В его состав входит 40% толуола, 30% бутилацетата и 30% ацетона. Данный растворитель также имеет модификацию – это Р-5А, которая используется в том случае если все выше перечисленные составы исключают возможность использования растворителя марки Р-5.

Если вы не знаете, чем еще заменить растворитель Р-4, тогда растворитель Р-12 – это еще один тип разбавителя, которым можно заменить Р4 состав. Состав данного вещества следующий: 60% толуола. 30% бутилацетата и 10% ксилола. Его используют для разбавления тех же ПСХ ЛН и ЛС смол, а также полиакриловых смол и иных пленкообразующих ЛКМ.

Все растворители выше представленных марок должны изготовляться в соответствии с ГОСТами 31089-2003 и 7827-74, по технологическому регламенту и рецептуре, утвержденными в установленном порядке предприятия.

Физико-химические свойства растворителя Р4 и его аналогов.

Если вы используете растворитель р4, чем можно его заменить понять достаточно трудно, поскольку нужно знать определенные характеристики этого вещества. Для различных поверхностей и ЛКМ применяют разные растворители этой группы, поэтому по наиболее приближенным показателям физико-химических свойств можно подобрать подходящую замену Р4 растворителю.

Растворители Р-4 и Р4-А обладают следующими физико-химическими свойствами:

  • Показатель массовой доли воды по Фишеру не превышает 0,7%.
  • Летучесть растворителя по этиловому эфиру от 5 до 15.
  • Кислотное число составляет не более 0,07 мг КОН/г.
  • Процентное число коагуляции не меньше чем 24%.
  • Температура вспышки (находясь в закрытом тигле) не ниже -10°С для растворителя Р-4 и -8°С для Р-4А.

Рассмотрим физико-химические свойства растворителя Р-5 и Р-5А:

  • Показатель массовой доли воды по Фишеру не превышает 0,7%.
  • Летучесть растворителя по этиловому эфиру от 9 до 15.
  • Кислотное число составляет не более 0,07 мг КОН/г.
  • Процентное число коагуляции не меньше чем 30%.
  • Температура вспышки (находясь в закрытом тигле) не ниже -12°С для растворителя Р-5 и -3°С для Р-5А.

И наконец физико-химические свойства растворителя Р-12 имеют следующие значения:

  • Показатель массовой доли воды по Фишеру не превышает 1,0%.
  • Летучесть растворителя по этиловому эфиру от 8 до 14.
  • Кислотное число составляет не более 0,10 мг КОН/г.
  • Процентное число коагуляции не меньше чем 22%.
  • Температура вспышки (находясь в закрытом тигле) не ниже -22°С.

Упаковка растворителя Р4 и его аналогов, а также маркировка, хранение и транспортирование.

Перед тем как заменять Р4 состав на другой тип растворителя, очень важно ознакомиться с требованиями к маркировке, упаковки, хранения и транспортирования. Это связано с тем, что нужно придерживать техники пожарной безопасности в каждом из этих случаев поскольку хотя физико-химические показатели растворителей очень близки, даже сотые доли отклонения могут сыграть ключевую роль.

Все растворители этой группы упаковываются в металлическую тару с узким горлом (фляги, канистры, барабаны и бочки) согласно разработанным ГОСТам и другой технической документации. Те растворители, которые предназначены для розничной продажи можно упаковывать в специальные канистры емкостью до 10 дм3, в стеклянную тару, в металлические банки, в полимерную потребительскую тару, изготовленную из полиэтилентерефталата. Укупорочные средства для тары должны обеспечивать максимальную герметичность и быть стойкими к химическому воздействию растворителей.

????Чем заменить растворитель Р4, аналоги для работы❓

Содержание статьи:

  • РАСТВОРИТЕЛЬ P4 – ОСОБЕННОСТИ ТЕХНИЧЕСКИХ ХАРАКТЕРИСТИК, СОСТАВ И ОБЛАСТЬ ПРИМЕНЕНИЯ
  • СОСТАВ РАСТВОРИТЕЛЯ
  • ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ РАСТВОРИТЕЛЯ
  • ГДЕ МОЖНО ЗАКАЗАТЬ Р4?
  • СКОЛЬКО РАСТВОРИТЕЛЯ НУЖНО, ЧТОБЫ РАЗБАВИТЬ КРАСКУ?
  • ЧЕМ ЖЕ ЗАМЕНИТЬ Р4?
  • ВЫВОД

К малярным работам в строительстве принадлежит отделка поверхностей – шпаклевка, покраска. Кузовная обработка тоже предусматривает использование различных красителей, лаков в соответствии с ГОСТ. Когда отделочника не удовлетворяет консистенция краски, он использует для разбавления привычное средство – P4. В ходе работ все случается, бывает, возникает острая проблема, чем заменить растворитель P4, таким веществам свойственно с невероятной скоростью улетучиваться. Если нет запасов в мастерской, придется отправляться в магазин, чтобы купить аналоги растворителя P4.

РАСТВОРИТЕЛЬ P4 – ОСОБЕННОСТИ ТЕХНИЧЕСКИХ ХАРАКТЕРИСТИК, СОСТАВ И ОБЛАСТЬ ПРИМЕНЕНИЯ

Краска не всегда бывает нужной густоты и тогда в ход идут растворители. Если приобрести растворитель P4, он разбавит вязкие красящие вещества, пригодится для удаления пятен, обезжиривания поверхностей, очистки кистей, избавит от многих лакокрасочных проблем.
В использовании растворителя P4 нет ничего особенного, он нужен, чтобы подготовить окрашиваемую поверхность, разбавить лакокрасочный материал. Если нет этой марки вещества, возникает резонный вопрос, чем можно заменить растворитель P4. Ответ простой – аналогом P4-A , химики много разработали видов подобных средств и внедрили в производство.
Растворитель марки Р4, изготовленный по ГОСТ – прозрачное жидкое вещество с легким желтым оттенком, не содержит PM, это взвешенные частицы (particulate matter), микроскопические загрязнители воздуха. Зато имеет резкий запах и высокую летучесть.

СОСТАВ РАСТВОРИТЕЛЯ

Производитель предупреждает, что при работе с растворителем Р4 нужно соблюдать осторожность, опасно для здоровья вдыхать пары и соприкасаться с кожей. Состоит растворитель из следующих компонентов:

  • активного элемента – толуола
  • простейшего представителя насыщенного кетона – ацетона
  • сложного эфира – бутилацетата

Фактически в состав растворителя Р4 включены смешанные летучие органические вещества:

  • ароматические
  • углеводороды
  • кетоны
  • спирты
  • эфиры

Благодаря бутилацетату краситель не только становится менее вязким, более жидким, но и усиливается цвет его оттенка.

ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ РАСТВОРИТЕЛЯ

Р4 способен самовоспламеняться, если окружающая среда будет нагрета до +5000С. Рядом с открытой бутылкой растворителя и во время работы не следует зажигать спичку или зажигалку, курить. Потому что даже пары могут воспламениться от открытого огня. Производитель фасует жидкость в пластиковые или стеклянные емкости. В сопроводительной документации или инструкции по применению указывает технические характеристики в отношении:

  • коагуляционного числа равного 24%
  • состава воды – 0.7%
  • коэффициента летучести – 5-15
  • кислотности – до 0.07 Кон/г
  • плотности – 0.85 м3

Если в магазине нет Р4, его не трудно заменить, рекомендуется перед покупкой изучить на этикетке аналога его характерные свойства.

ОСНОВНАЯ СФЕРА ПРИМЕНЕНИЯ РАСТВОРИТЕЛЯ Р4

Растворитель предназначен растворять вязкий, не пригодный для немедленного использования:

  • краситель или лак
  • шпатлевку
  • эмаль
  • грунтовку

При условии, что маркировка лакокрасочных изделий:

  • ХС
  • ХВ
  • ПХВ
  • МС
  • ЭП-0020

Растворитель в умеренных количествах применяют, чтобы размягчить воду, добавив Р4 в мыльный раствор, можно мыть руки, посуду. Основной сферой применения являются отделочные работы поверхностей зданий, кузовов машин. Эфирную смесь химики специально разработали для красок, в основе которых содержится смола из категории:

  • винилхлоридных
  • эпоксидных
  • поливинилхлоридных
  • хлорированных

Используют растворитель для разбавления синтетических или натуральных пленкообразующих составов. Это вещество благодаря универсальности, широко применяется в ремонтных работах. Потому что способно снизить расход краски. При отличном качестве, жидкого красителя меньше расходуется, чем густого. Растворитель применяют в других отраслях, когда нужно склеить обувь, части приборов, мебели. Р4 используют для очистки поверхностей от жиров.

ГДЕ МОЖНО ЗАКАЗАТЬ Р4?

Завод ЯСХИМ лидирует на всей территории России в сегменте рынка по производству нефтехимических растворителей. Крупнейший производитель гарантирует качество продукции и постоянное наличие растворителей, нужной марки на собственном складе. Компания гордится стабильными поставками и оперативной логистикой в течение 20 летней деятельности. Завод оснащен современным оборудованием, специалисты используют инновационные технологии и собственную рецептуру. Сопроводительная документация, сертификаты качества подтверждают, что продукция изготовлена в соответствии с ГОСТ и ТУ Российской Федерации.
Менеджеры Ясхим принимает заказы на растворители в необходимом клиенту объеме, а специалисты готовы изготовить вещество по рецепту заказчика – в разумных пределах.
На производственных площадках завода находятся цеха, где производят:

  • олифу
  • битумный лак
  • номерные растворители

В больших складах есть такой запас продуктов производства, который способен удовлетворить запрос заказчика.

СКОЛЬКО РАСТВОРИТЕЛЯ НУЖНО, ЧТОБЫ РАЗБАВИТЬ КРАСКУ?

Добавка растворителя в краску или лак зависит от густоты лакокрасочных веществ. Мастер вливает малыми порциями в банку с красителем и тщательно размешивает до нужной вязкости. Маляру на визуальном уровне становится понятно, когда нужно остановиться. Обычно краска становится эффективно разбавленной, если влить около 10% растворителя от общей массы материала. Важно уберечь краситель от попадания воды, влага влияет на изменение цвета, а прозрачная краска может неприятно побелеть, станет с мутным оттенком.
Можно не экономить в дозах, если нужно обезжирить, очистить поверхность от загрязнений. Растворитель быстро улетучивается, поэтому отделочник старается успеть качественно, обработать участок.
Перед тем как приступить к разбавлению вязкой, загустевшей структуры, нужно изучить инструкцию к применению. Производитель учитывает мелочи, описывает каждый вид обработки. Допустим, грунтовка редко становится густой, не следует без необходимости разжижать и без того нормальную субстанцию.
Прежде чем вливать растворитель следует обратить внимание на факторы:

  • какой материал придется красить
  • параметры влажности и температуры среды, в которой находится площадь для отделки
  • год выпуска и бренд лакокрасящего средства
  • методику окрашивания

К примеру, для нанесения красителя или лака пневматическим прибором, его придется наполовину разбавлять растворителем. Безвоздушный способ требует вливать 35% Р4.
Когда красят кистью достаточно добавить 15% растворителя от основной массы. Можно самостоятельно рассчитать расход раствора. Узнать из инструкции, сколько пойдет краски на 1м2, покрасить и проверить по банке количество израсходованного состава. Густого вещества израсходуется больше, чем положено по норме.

ЧЕМ ЖЕ ЗАМЕНИТЬ Р4?

Химическая промышленность оснащена всеми инновационными технологиями. На производственных площадках установлено современное оборудование, поэтому заменить растворитель Р4 не составит особых трудностей. Многие растворители оснащены похожими техническими характеристиками с незначительным отличием по параметрам, составу ингредиентов и уровню реакции на лакокрасочные продукты. Производственники считают, аналоги растворителя Р4, это:

  • P4a – состав можно использовать для разбавления высокоустойчивой эмали типа ХВ-124
  • Р5 и Р5а – средства имеют большее коагуляционные число – 30%, остальное количество компонентов в содержании смеси не отличается
  • Р-12 – в растворителе увеличен состав воды –1%, коагуляция равна 22%, нет ацетона, заменен ксилолом. Нужно с осторожностью применять, исключить контакты или смешивание с уксусом, азотной кислотой, перекисью водорода – взрывоопасно

Замену нужно делать, соблюдая требование. Прежде изучают инструкцию, определяют, какие ЛКП предстоит разжижать. Красители и растворители, продукты химических соединений, поэтому прежде чем заменять другой маркой, нужно узнать о совместимости веществ. Если лакокрасочное изделие и растворитель не подойдут, их компоненты свернутся или начнут расслаиваться. Стоит учесть горючесть и токсичность аналогов Р4, которые в одинаковом порядке требуют соблюдения техники безопасности и надлежащего хранения.

ВЫВОД

Растворитель Р4 отличный выбор для использования в ремонтных работах. С его помощью можно сократить расход краски, сам процесс окрашивания поверхностей станет намного легче. Только перед применением нужно ознакомиться не только с химическим составом растворителя, а определить тип краски, грунтовки, узнать об обоюдном взаимодействии. Для собственного здоровья необходимо позаботиться о средствах защиты, учитывая способность растворителя вызывать отравление даже в небольших количествах при кратковременной работе. Если предстоит ремонт, защитит респиратор с перчатками.

Улучшенный синтез 4-цианотриптофана и других аналогов триптофана в водном растворителе с использованием вариантов TrpB от Thermotoga maritima

  • Список журналов
  • Рукописи авторов HHS
  • PMC6054569

J Оргхим. Авторская рукопись; доступно в PMC 201920 июля.

Опубликовано в окончательной редакции как:

J Org Chem. 20 июля 2018 г .; 83 (14): 7447–7452.

Published online 2018 Apr 27. doi: 10.1021/acs. joc.8b00517

PMCID: PMC6054569

NIHMSID: NIHMS960701

PMID: 29651849

Author information Copyright and License information Disclaimer

Supplementary Materials

The использование ферментов становится все более распространенным в синтезе, поскольку химики стремятся уменьшить свою зависимость от органических растворителей в пользу более экологически безопасных водных сред. Имея это в виду, мы ранее пытались разработать β-субъединицу триптофансинтазы (TrpB) для производства неканонических аминокислот, которые ранее были синтезированы многоэтапными способами с использованием чувствительных к воде реагентов. Эта ферментативная платформа оказалась эффективной для синтеза аналогов аминокислоты триптофана (Trp), которые часто используются в фармацевтическом синтезе, а также в химической биологии. Однако некоторые ценные соединения, такие как голубая флуоресцентная аминокислота 4-цианотриптофан (4-CN-Trp), могут быть получены только с низким выходом даже при повышенной температуре (75°C). Здесь мы описываем разработку TrpB из Thermotoga maritima , который улучшил синтез 4-CN-Trp с 24% до 78%. Примечательно, что хотя конечный фермент сохраняет высокую термостабильность ( T 50 = 93°C), его температурный профиль сдвинут, так что высокая реакционная способность наблюдается при ~37°C (выход 76%), что создает возможность для производство 4-CN-Trp in vivo. Улучшения не относятся к 4-CN-Trp; повышение активности при более низкой температуре также продемонстрировано для других аналогов Trp.

Неканонические α -аминокислоты (NCAA) напоминают строительные блоки природных белков, но сами по себе не используются в синтезе белков. Несмотря на это, NCAA являются прекурсорами функциональных синтетических соединений, в том числе более 12% из 200 самых продаваемых фармацевтических препаратов. 1 Тем не менее, ncAA представляют собой сложные синтетические мишени, поскольку они содержат как минимум две реакционноспособные функциональные группы (аминогруппу и карбоновую кислоту) и обычно имеют по крайней мере один стереоцентр. В результате синтетические способы получения NCAA обычно требуют нескольких стадий, в большинстве из которых используются органические растворители. 2,3 Один из наиболее прямых путей к NCAA — это добавление нуклеофила в β-положение лактона, полученного из серина 4–6 или азиридина 7,8 (), но этот подход имеет определенные недостатки , такие как необходимость предварительного синтеза чувствительных к воде электрофильных реагентов.

Открыть в отдельном окне

Синтез аминокислот путем нуклеофильного замещения в β-положении. (a) Подход с использованием предварительно приготовленного лактона или азиридина. (b) Кофактор, используемый ферментами TrpB. (c) Альтернативный подход, при котором фермент образует аминоакрилат in situ из стабильных предшественников, таких как серин. Boc, трет--бутоксикарбонил; Ts, 4-толуолсульфонил; PG, защитная группа.

Ферменты широко применяются для синтеза NCAA, поскольку они позволяют обойти многие ограничения химических методов. Эти катализаторы не только функционируют в водной среде, но также проявляют хемоселективность, которая устраняет необходимость в защитных группах, тем самым сокращая этапы синтеза. Кроме того, реакции часто очень стереоселективны. К сожалению, большинство ферментативных методов синтеза ncAA, таких как те, которые основаны на гидролазах или трансаминазах, требуют, чтобы большая часть конечного продукта была синтезирована заранее, обычно химическими средствами, при этом фермент появляется только в конце, чтобы установить стереохимию. Напротив, такие ферменты, как триптофансинтаза, 9–14 , в котором используется кофактор пиридоксаль-5'-фосфат (PLP, ), может образовывать NCAA путем нуклеофильного замещения в β-положении легкодоступных аминокислот, таких как серин. В этой схеме реакции фермент образует активную электрофильную частицу, аминоакрилат (), непосредственно в активном центре, который затем перехватывается нуклеофильным субстратом. Эти реакции можно проводить в водных условиях, которые гидролизуют производные серина лактоны или азиридины. Кроме того, активный центр фермента может связывать субстраты, ускоряя реакцию и контролируя региоселективность нуклеофильного замещения.

Ранее сообщалось, что 4-цианотриптофан ncAA (4-CN-Trp) проявляет голубую флуоресценцию (λ макс. ~ 405 нм) с высоким квантовым выходом и длительным сроком службы. 15 Эти свойства, среди прочего, делают 4-CN-Trp привлекательным низкомолекулярным флуорофором для исследований in vitro и in vivo . Однако химический синтез требует нескольких стадий, включая реакцию цианирования с низким выходом, катализируемую палладием. Мы были рады обнаружить, что сконструированный вариант β-субъединицы триптофансинтазы (TrpB) из гипертермофильной бактерии Thermotoga maritima может образовывать 4-цианотриптофан в одну стадию из легко доступных 4-цианоиндола и серина (). 16 Поэтому мы хотели разработать этот вариант для дальнейшего улучшения производства 4-CN-Trp.

Открыть в отдельном окне

Прямой синтез 4-цианотриптофана

Повышение активности с помощью 4-цианоиндола

В качестве исходного фермента мы выбрали вариант, обозначенный Tm 2F3 (), который получен из T. maritima TrpB и имеет семь мутаций. Мы выбрали этот вариант, поскольку в предыдущих исследованиях он проявлял высокую активность по отношению к другим 4-замещенным индольным субстратам. 16 Кроме того, этот вариант, как и его предок дикого типа, выдерживал высокие температуры (до 75°C), что ускоряло реакцию. При разработке вариантов Tm , происходящих от TrpB, мы обнаружили, что активирующие мутации распределялись по всей последовательности белка без каких-либо очевидных закономерностей. Единственным исключением была мутация I184F, которая находится в предполагаемом активном центре фермента. Хотя включение мутации I184F увеличивало продукцию 4-CN-Trp с Tm 2F3, 16 это не было полезным для других 4-замещенных индолов. Поэтому в дальнейшем мы решили исключить мутацию I184F и вместо этого провести глобальный случайный мутагенез на гене Tm 2F3 с возможностью повторного посещения I184 на более позднем этапе.

Table 1

Summary of T. maritima TrpB variants

Designation Mutations T 50 (° C) a
Tm 2F3 P19G, I69V, K96L, P140L, N167D, L213P, T292S 91.5 ± 0.8
Tm 9D8 Tm 2F3 + E30G, G228S 88.2 ± 0.7
Tm 9D8* Tm 9D8 + I184F 92. 7 ± 0.2

Open in a separate window

a Measurements conducted in triplicate.

Из тестовых реакций мы наблюдали, что превращение 4-цианоиндола в 4-CN-Trp сопровождалось увеличением поглощения при 350 нм. Этот спектральный сдвиг позволил нам быстро просмотреть библиотеку ферментов, проведя реакции в 96-луночных планшетах, а затем отслеживая изменение поглощения при 350 нм с помощью планшет-ридера. После скрининга 1760 клонов мы идентифицировали новый вариант Tm 9D8 (E30G и G228S), который показал 2,5-кратное увеличение выхода 4-CN-Trp. Странно, когда мы перепроверили Tm 9D8 во флаконах, мы обнаружили, что он не более активен, чем родительский Tm 2F3 (+). Мы предположили, что, хотя реакции в планшете и в пробирке якобы проводились при одинаковой температуре (75°C), реакционные смеси в планшете на самом деле могли иметь более низкую температуру из-за присущих им трудностей при равномерном нагреве 96-луночного планшета. Поэтому мы повторно протестировали Tm 9D8 и Tm 2F3 при более низких температурах и обнаружили, что Tm 9D8 почти в 2 раза лучше, чем 9D8.0013 Tm 2F3 при 50°С и почти в 5 раз лучше при 37°С. Примечательно, что Tm 9D8 работал лучше при 37°C, чем Tm 2F3 при 75°C. Эта способность функционировать при более низкой температуре не только выгодна для разработки процесса, но также создает возможность синтеза 4-CN-Trp in vivo .

Открыть в отдельном окне

Получение 4-CN-Trp при различных температурах из эквимолярного 4-цианоиндола и серина (максимум 1000 оборотов). Урожайность является средним из двух повторностей. Полные данные представлены в таблице S1.

Ранее мы обнаружили, что введение мутации I184F в Tm 2F3 улучшило продукцию 4-CN-Trp. 16 Поэтому мы сконструировали рекомбинационную библиотеку из 8 вариантов, в которой положения 30, 184 и 228 могли быть либо остатками дикого типа, либо мутантными остатками. Скрининг этого набора покажет, были ли E30G и G228S ответственны за улучшение первого раунда и был ли I184F по-прежнему полезен в этом новом варианте. Мы обнаружили, что лучший вариант, Tm 9D8*, действительно сохранил все три мутации, повышая продукцию 4-CN-Trp до ~76–78% как при 37, так и при 50°C (1). Мы также протестировали библиотеки, в которых позиции 30, 184 и 228 были рандомизированы отдельно для всех двадцати канонических аминокислот; скрининг показал, что предпочтение отдается глицину и серину в положениях 30 и 228 соответственно (см. рисунки S1 и S2). В положении 184 лейцин также улучшал активность по сравнению с нативным изолейцином (см. рис. S3), но повторный скрининг показал, что эта мутация не так полезна, как фенилаланин. Таким образом, мы приняли Tm 9D8* для производства 4-CN-Trp.

Крупносерийное производство 4-CN-Trp

Хотя окончательный вариант имеет низкую начальную частоту оборотов (0,95 ± 0,05 мин -1 при 37°C) и требует относительно высокой загрузки катализатора (0,1 мол. %), для достижения выходов в , уровень его экспрессии таков, что фермент из 1 л культуры может синтезировать почти 800 мг 4-CN-Trp при 55°C (). Поскольку реакцию проводят в водной среде, большая часть продукта осаждается непосредственно из реакционной смеси и может быть очищена с помощью простых стадий промывки. Новый вариант также сохраняет превосходную термостабильность ( T 50 ~90°C) (), что позволяет получать его в виде термообработанного лизата, облегчая удаление клеточного дебриса, и использовать в присутствии органических растворителей, улучшая растворимость гидрофобных субстратов.

Открыть в отдельном окне

Ферментативный препарат 4-CN-Trp

Активность с другими субстратами

Мы протестировали варианты TrpB с другими аналогами индола, чтобы увидеть, как мутации влияют на специфичность (). Чтобы подчеркнуть улучшенную активность при более низкой температуре, реакции с Tm 2F3 и Tm 9D8 подвергали скринингу при 50°C, тогда как реакции с Tm 9D8* подвергали скринингу при 37°C. Хотя Tm 2F3 уже проявляет хорошую активность (3250 оборотов при 50°C) с 4-броминдолом ( 1 ), активность улучшается в более поздних вариантах, при этом Tm 9D8* выполняет аналогичное количество оборотов (3750 ), но при более низкой температуре (37°С). Однако все варианты проявляли незначительную активность в отношении 4-нитроиндола ( 2 ), что позволяет предположить, что активный центр очень чувствителен к геометрии заместителей в 4-м положении.

Открыть в отдельном окне

Выход ВЭЖХ аналогов TRP с вариантами TRPB A

A Реакции были 0,02 -молосовые. субстраты.

b Реакции протекают при 50°C.

c Реакции протекают при 37°C. Красные кружки обозначают место образования связи С-С. Урожайность является средним из двух повторностей. Полные данные представлены в таблице S3.

Ранее варианты T. maritima TrpB показали лучшие результаты в реакциях с 5-замещенными индолами. 16,17 Однако 5-нитроиндол ( 3 ) продемонстрировал значительно худшие результаты с более поздними вариантами по сравнению с Tm 2F3. Более поздние варианты, однако, продемонстрировали значительные улучшения с 5,7-дизамещенными субстратами, обеспечив почти количественную конверсию 4 в продукт даже при 37°C. С подложкой 5 активность улучшается почти на порядок по сравнению с исходным вариантом.

Влияние эволюции на активность TrpB

4-Цианоиндол является особенно сложным субстратом, поскольку его нуклеофильность ослабляется как электронным образом из-за электроноакцепторного влияния цианогруппы, так и стерически, поскольку заместители в 4-м положении перекрывают место образования связи С-С. Однако новый вариант Tm 9D8* проявляет улучшенную активность с этим субстратом и хорошо функционирует даже при 37°C. Высокий уровень экспрессии белка (~40 мг Tm 9D8* на л культуры), доступность исходных материалов, а также удобная организация реакции и извлечение продукта делают этот метод эффективным для лабораторного получения 4-CN-Trp.

Обнаружено, что мутации, повышающие активность 4-цианоиндола, также улучшают активность при более низких температурах других структурно и электронных субстратов, таких как 4-броминдол ( 1 ) и дизамещенные индолы 4 и 5 . Во всех случаях окончательный вариант Tm 9D8* давал более высокий выход при 37°C, чем исходный вариант Tm 2F3 при 50°C. Это общее повышение активности при более низкой температуре ценно, поскольку оно не только облегчает разработку процесса, но и позволяет в будущем исследовать субстраты, которые могут быть нестабильными в воде при повышенной температуре. Мутации, однако, не вызывали общей толерантности к 4-замещению, так как фермент проявлял незначительную активность с 4-нитроиндолом ( 2 ). Удивительно, но активность с 5-нитроиндолом ( 3 ) резко сократилось, несмотря на то, что Tm 2F3 изначально был выведен для работы с этим субстратом. 16 Эти данные свидетельствуют о том, что мутации значительно изменили конфигурацию активного сайта по сравнению с Tm 2F3, хотя активность с индолом нативного субстрата остается высокой для всех вариантов (см. вспомогательную информацию).

Роль мутаций

Все семь мутаций в исходном белке Tm 2F3 были ранее идентифицированы в гомологе TrpB из Pyrococcus furiosus , который был получен путем глобального случайного мутагенеза и скрининга, чтобы принять 4-нитроиндол в качестве нуклеофильного субстрата. Хотя гомолог P. furiosus имеет только 64% ​​идентичности последовательности с T. maritima TrpB, 17 , мы обнаружили, что эти семь мутаций активировались в обоих белковых каркасах. Кроме того, гомологичные варианты имели разные профили субстрата, при этом вариант T. maritima работал лучше, чем P. furiosus с 4- или 5-замещенными индолами, подобными показанным на .

На сегодняшний день наши попытки решить кристаллическую структуру вариантов T. maritima TrpB не увенчались успехом. Поэтому мы построили модель гомологии 18 на основе кристаллической структуры 1,65 Å S. typhimurium TrpB (идентификатор PDB: 4hpx, 58% идентичности последовательности) 19 с PLP-связанным аминоакрилатом в активном центре. . Из этой модели видно, что из десяти мутаций в Tm 9D8*, только два находятся в активном центре (I184F и G228S), а остальные восемь разбросаны по всей структуре белка (). Точные эффекты этих восьми мутаций неизвестны, но предыдущие исследования показали, что они стабилизируют закрытое состояние фермента, 16,17 , который, как известно, способствует образованию продукта.

Открыть в отдельном окне. в позе реактивного связывания, а остатки, которые, по прогнозам, взаимодействуют с 4-цианоиндолом, выделены.

Мутация G228S поразительна не только потому, что она является мутацией активного сайта, но и потому, что, по прогнозам, она возникает в начале петли ( G GGS), которая связывает фосфатную часть кофактора PLP. Чтобы размышлять о роли этой мутации, мы смоделировали 4-цианоиндол в предполагаемой позе связывания, необходимой для образования связи С-С. Боковые цепи остатков L162, I166 и V188 простираются в активный центр и, таким образом, ожидается, что они будут влиять на расположение индольного субстрата посредством гидрофобных взаимодействий. Активный центр также содержит E105, универсальный консервативный остаток, который взаимодействует с эндоциклическим N-H нативного субстрата, индола. Сразу видно, что 4-цианозаместитель указывает прямо на фосфатсвязывающую петлю и, в частности, на G228. Таким образом, мутация G228S может реорганизовать сайт связывания кофактора, чтобы создать место для заместителей в 4-м положении. Обзор 5738 гомологов TrpB показал, что эта последовательность GGGS почти повсеместно консервативна. Таким образом, этот вариант служит примером того, как мутации универсально консервативных остатков могут способствовать реакциям с неприродными субстратами.

Применяя глобальный случайный мутагенез к TrpB из T. maritima , мы разработали вариант с улучшенной активностью для производства 4-CN-Trp непосредственно из 4-цианоиндола и серина. В то время как исходный фермент изо всех сил пытался образовать 4-CN-Trp при 75 ° C, этот новый вариант проявляет значительную активность даже при 37 ° C, позволяя производить 4-CN-Trp в мягких условиях. Реакции, катализируемые TrpB, происходят в водной среде с легкодоступными исходными материалами и без необходимости использования защитных групп. Таким образом, мы считаем, что платформа TrpB послужит мощным инструментом для разработки более эффективных и прямых путей получения ncAA, сводящих к минимуму использование органических растворителей.

Общие экспериментальные методы

Химикаты и реагенты приобретались из коммерческих источников и использовались без дополнительной очистки. Спектр протонного ЯМР регистрировали на спектрометре Bruker 400 MHz (100 MHz), снабженном криогенным зондом. Химические сдвиги протонов приведены в м.д. (δ) относительно тетраметилсилана и откалиброваны с использованием остаточного резонанса растворителя (ДМСО, δ 2,50 м.д.). Спектр ЯМР регистрировали при температуре окружающей среды (около 25°С). Препаративную обращенно-фазовую хроматографию проводили на системе очистки Biotage Isolera One с использованием силикагеля С-18 в качестве стационарной фазы, с CH 3 OH в качестве сильного растворителя и H 2 O (0,1% HCl по весу) в качестве слабого растворителя. Жидкостную хроматографию/масс-спектрометрию (ЖХ-МС) выполняли на УЭЖХ-МС Agilent 1290, оснащенной колонкой с силикагелем C-18 (1,8 мкм, 2,1 × 50 мм), используя CH 3 CN/H 2 O (0,1% уксусной кислоты). кислота по объему): от 5% до 95% CH 3 CN в течение 4 мин; 1 мл/мин. Оптическую чистоту продуктов определяли дериватизацией N -(5-фтор-2,4-динитрофенил)аланамидом (ФДНФ-аланамид) 20 , как описано ниже.

Клонирование, экспрессия и очистка вариантов

Tm TrpB

Tm TrpB (UNIPROT ID {"type":"entrez-protein","attrs":{"text":"P50909","term_id" :"1717761","term_text":"P50909"}}P50909) ранее был клонирован в pET22(b)+ между сайтами Nde I и Xho I с 6-кратной С-концевой His-меткой. 17 В этом исследовании использовали ранее описанный вариант Tm 2F3 16 в качестве родителя для последующей эволюции. Все варианты были экспрессированы в BL21(DE3) E. cloni 9.0045 ® Экспресс-клетки. Культуры начинали с одиночных колоний в 5 мл бульона Terrific, дополненного 100 мкг/мл ампициллина (TB amp ), и инкубировали в течение ночи при 37°C и 230 об/мин. Для экспрессии использовали 2,5 мл ночной культуры для инокуляции 250 мл TB amp в 1-литровую колбу, которую инкубировали при 37°C и 250 об/мин в течение трех часов до достижения OD 600 от 0,6 до 0,8. Культуры охлаждали на льду в течение 20 минут и экспрессию индуцировали с помощью конечной концентрации 1 мМ изопропил-β-D-тиогалактопиранозида (IPTG). Экспрессию проводили в течение ночи (примерно 20 часов) при 25°С и 250 об/мин. Клетки собирали центрифугированием при 5000 град.0013 г в течение пяти минут при 4°С и хранят при -20°С.

Размороженные осадки клеток ресуспендировали в 9 мл лизирующего буфера, содержащего 50 мМ калий-фосфатного буфера, pH 8,0 (буфер KPi) с 1 мг/мл лизоцима куриного яичного белка (HEWL), 200 мкМ PLP, 2 мМ MgCl 2 , 0,02 мг/мл ДНКазы I. Осадки встряхивали до полного ресуспендирования, а затем клетки лизировали с помощью BugBuster ® в соответствии с рекомендациями производителя. Затем лизаты подвергали термообработке при 75°С в течение 10 минут. Лизат центрифугировали в течение 15 минут при 15000×9.0,013 г и 4°С и супернатант собирали. Очистку проводили с помощью системы AKTA Purifier FPLC (GE Healthcare) и колонки Ni-NTA объемом 1 мл. Белок элюировали, применяя линейный градиент от 100 мМ до 500 мМ имидазола в 25 мМ буфере KPi и 100 мМ NaCl. Фракции, содержащие очищенный белок, подвергали диализу в 50 мМ буфере KPi, мгновенно замораживали в жидком азоте и хранили при -80°C. Концентрацию белка определяли с использованием анализа белка Bio-Rad Quick Start™ Bradford.

Создание библиотек случайного мутагенеза

Библиотеки случайного мутагенеза были созданы из гена, кодирующего Tm 2F3, путем добавления от 200 до 400 мкМ MnCl 2 в реакцию ПЦР Taq, как сообщалось ранее. 16,21 ПЦР-фрагменты обрабатывали Dpn I в течение двух часов при 37°C и очищали гель-экстракцией. Затем очищенную библиотеку клонировали в пустой вектор pET22(b)+ с помощью сборки Гибсона и трансформировали в BL21(DE3) E. cloni 9.0045 ® Экспресс-клетки. 22

  • Forward primer ( Nde I): GAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATG

  • Reverse primer ( Xho I): GCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAG

Construction of recombination libraries

Recombination libraries used primers with a degenerate codon to вызывают 50/50 амплификацию мутантных остатков и остатков дикого типа в данном сайте (E30G, I184F, G228S) (таблица S4). ПЦР с Phusion 9Полимераза 0045® (NEB) продуцировала четыре фрагмента гена Tm 2F3 ( NdeI от до E30, E30 до I184, I184 до G228, G228 до XhoI ). Фрагменты обрабатывали Dpn I в течение двух часов при 37°С и очищали гель-экстракцией. Фрагменты собирали методом ПЦР с фланкирующими праймерами, соответствующими сайтам Nde I и Xho I вектора pET-22(b)+. Затем собранный ген клонировали в пустой вектор pET22(b)+ через сборки Гибсона и трансформировали в экспресс-клетки BL21(DE3) E. cloni ® . 22

Создание библиотек сайт-насыщения

Библиотеки сайта-насыщения были созданы с использованием набора NEB Q5 ® для сайт-направленного мутагенеза в соответствии с инструкциями производителя с использованием Tm 9D8 в качестве родителя. Праймеры были разработаны с использованием программного обеспечения NEBaseChanger ® и включали вырожденные кодоны NDT (кодирование Ile, Asn, Ser, Gly, Asp, Val, Arg, His, Leu, Phe, Tyr и Cys), VHG (кодирование Met, Thr, Lys, Glu, Ala, Val, Gln, Pro и Leu) и TGG (Trp) в интересующем остатке (таблица S5). Праймеры смешивали, как сообщалось ранее. 23 После ПЦР образцы обрабатывали KLD Enzyme Mix в течение пяти минут и трансформировали в экспресс-клетки BL21(DE3) E. cloni ® .

Библиотечная экспрессия и скрининг

Клетки BL21(DE3) E. cloni ® , несущие вариантные плазмиды, культивировали в 96-луночных планшетах с глубокими лунками вместе с родительским и отрицательным контролем, как описано ранее. 16,21 Ночные культуры выращивали путем инокуляции 300 мкл TB amp одной колонией с последующей инкубацией при 37 °C и 250 об/мин при влажности 80%. На следующий день 20 мкл ночной культуры добавляли к 630 мкл ТВ-9.0037 amp и инкубировали при 37°С и 250 об/мин при влажности 80% в течение 3 часов. Затем клетки охлаждали на льду в течение 20 минут и индуцировали добавлением IPTG (конечная концентрация 1 мМ) с последующей инкубацией при 25°С и 250 об/мин в течение ночи (примерно 20 часов). Клетки осаждали центрифугированием при 5000 g в течение 5 минут, затем декантировали и хранили при -20°С. Клеточные планшеты оттаивали и ресуспендировали в 300 мкл/лунку 50 мМ буфера KPi с 1 мг/мл HEWL, 200 мкМ PLP, 2 мМ MgCl 2 и 0,02 мг/мл ДНКазы. Клетки лизировали путем 30-минутной инкубации при 37°С и термообработки на водяной бане при 75°С в течение от 30 минут (рекомбинация и насыщение участка) до 180 минут (случайный мутагенез). Лизат осветляли центрифугированием при 5000 g в течение 10 минут.

Случайный скрининг мутагенеза

Реакции проводили в УФ-прозрачном 96-луночном планшете с общим объемом 200 мкл/лунку, содержащем 40 мкл термообработанного лизата, 5 мМ 4-цианоиндола и 50 мМ серина с 5 % (об./об.) ДМСО в 50 мМ буфере KPi. Реакции протекали на водяной бане при 75°С в течение 24 часов. Планшеты кратковременно центрифугировали для сбора конденсата и анализировали путем измерения поглощения при 350 нм.

Скрининг рекомбинации и насыщения сайта

Реакции проводили в 96-луночных планшетах с глубокими лунками общим объемом 200 мкл/лунку, состоящих из 40 мкл термообработанного лизата, 5 мМ 4-цианоиндола и 50 мМ серина с 5 % (об. /об.) ДМСО в 50 мМ буфере KPi. Реакции запечатывали тефлоновыми уплотнительными матами и инкубировали на водяной бане при 75°С в течение 24 часов. Планшеты кратковременно охлаждали на льду и центрифугировали для сбора конденсата. В каждую лунку вносили по 500 мкл 1-М водн. HCl и 500 мкл этилацетата. Планшет закрывали тефлоновым уплотнительным матом с последующим интенсивным перемешиванием для растворения всех осадков и распределения продукта и субстрата между водной и органической фазами соответственно. Планшеты центрифугировали в течение 2 минут при 5000 град.0013 г , а затем 200 мкл водной фазы переносили в 96-луночный планшет для анализа, прозрачный для УФ-излучения. Активность определяли путем измерения поглощения при 300 нм.

Калибровка для измерения выхода ВЭЖХ

С использованием аутентичного стандарта были приготовлены смеси соответствующих аналогов индола и триптофана в различных соотношениях (9:1, 3:1, 1:1, 1:3 и 1:9) в 1 :1 1-М водн. HCl/CH 3 CN с общей концентрацией 1 мМ. Каждую смесь готовили в двух экземплярах, а затем анализировали с помощью ЖХ-МС. Отношения пиков продукта и субстрата при 254 нм и 280 нм (эталон 360 нм, ширина полосы 100 нм) коррелировали с фактическими отношениями линейной зависимостью (см. Рисунок S4). Аутентичный стандарт 4-цианотриптофана был получен из граммового препарата, описанного ниже. Аутентичные стандарты 4-бромтриптофана, 5-нитротриптофана и 5-бром-7-фтортиптофана были синтезированы, как сообщалось ранее. 16

Реакции для и

Стеклянный флакон для ВЭЖХ объемом 2 мл загружали нуклеофильным субстратом в виде раствора в ДМСО (10 мкл, 400 мМ). Затем добавляли серин (конечная концентрация 20 мМ) и очищенный фермент (конечная концентрация либо 4 мкМ, либо 20 мкМ) в виде раствора в 190 мкл 50 мМ буфера KPi. Реакции нагревали до 37°С, 50°С или 75°С в течение 24 часов. Затем реакционную смесь разбавляли 800 мкл 1:1 1-М водн. HCl/CH 3 CN и тщательно взбалтывают. Наконец, реакционную смесь центрифугировали при >20 000 г в течение 10 минут, и супернатант анализировали с помощью ВЭЖХ. Идентичность продукта была подтверждена сравнением с подлинным стандартом. Выход определяли путем сравнения интеграций пиков ВЭЖХ, соответствующих продукту и исходному материалу (дополнительные сведения см. в разделе «Вспомогательная информация»). Эксперименты проводились как минимум в двух повторностях.

Аппроксимация начальной частоты оборота

Реакции с 4-цианоиндолом ставили по методике, описанной выше для . Реакции обрабатывали через 1 час и анализировали с помощью ВЭЖХ. Интеграция пиков поглощения при 254 нм, соответствующих продукту и исходному материалу, использовалась для расчета образования продукта. Реакции проводили в трехкратной повторности. Полные данные см. в таблице S2.

Препарат 4-цианотриптофана в пересчете на грамм

Термически обработанный лизат готовили в соответствии с описанным выше протоколом приготовления ферментов для очистки. В колбе Эрленмейера объемом 1 л 4-цианоиндол (1,0 г, 7,0 ммоль) и серин (810 мг, 7,7 ммоль) суспендировали в ДМСО (17,5 мл) и 50 мМ буфере KPi (250 мл). Добавляли термообработанный лизат из четырех экспрессионных культур объемом 250 мл, затем реакционную смесь нагревали на водяной бане при 55°С. Через 72 часа реакционную смесь охлаждали на льду в течение 90 минут. Осадок собирали фильтрованием, дважды промывали этилацетатом и дважды водой, затем сушили в вакууме с получением 4-CN-Trp в виде не совсем белого твердого вещества (797 мг, выход 49%).

Спектр ЯМР 1 H снят в смеси ДМСО-d 6 и 20% DCl/D 2 O и соотнесен с остаточным пиком ДМСО (2,50 м.д.). 1 H ЯМР (400 МГц, ДМСО- d 6 ) δ 7,57 (дд, J = 8,2, 1,0 Гц, 1H), 7,32 (с, 1H), 7,32 (с, 1H), 7,32(м, 1H), 7,09–7,03 (м, 1H), 4,00 (дд, Дж = 5,8, 2,9 Гц, 1H), 3,30 ( AB X, Дж AX = 8,7 Гц, Дж BX = 6,2 Гц, J AB = 15,2 Гц, ν AB = 85,2 Гц, 2H). Данные соответствовали предыдущей литературе. 16

Определение значений

T 50

Мастер-микс 1 мкМ очищенного фермента готовили в 50 мМ буфере KPi, и 95 мкл добавляли в 12 пробирок для ПЦР. Десять испытуемых образцов инкубировали в термоциклере в течение 60 минут при градиенте температуры от 79°C до 99°C, а два контрольных образца инкубировали при комнатной температуре. Все пробирки центрифугировали в течение трех минут для осаждения фермента, а затем 75 мкл супернатанта переносили из каждой пробирки в УФ-прозрачный 96-луночный планшет для анализа. Активность фермента определяли, добавляя в каждую лунку дополнительно 75 мкл 50 мМ буфера KPi, содержащего 1 мМ индола и 1 мМ серина. Реакции инкубировали в течение 45 мин при 50°C ( Tm 9D8 и Tm 9D8*) или 75°C ( Tm 9).0014 2F3), затем кратковременно центрифугируют для сбора конденсата. Активность определяли путем измерения поглощения при 290 нм. Активность коррелировали с температурой инкубации и определяли температуры полуинактивации ( T 50 ). Измерения проводились в трехкратной повторности.

Определение оптической чистоты

Оптическую чистоту продуктов оценивали дериватизацией ФДНФ-аланамидом. Во флаконе объемом 2 мл проводили реакцию объемом 200 мкл, как описано выше. Через 24 часа инкубации при 37°С 100 мкл 1 М водн. NaHCO 9В реакционную смесь добавляли 0037 3 и 125 мкл реакционной смеси (до 1,1 мкмоль продукта) переносили в две пробирки по 2 мл. В каждый флакон добавляли ФДНФ-аланамид (33 мкл 33-мМ раствора в ацетоне, 1,1 мкмоль) с последующей инкубацией при 37°С и 230 об/мин. Через два часа реакционную смесь охлаждали до комнатной температуры и затем разбавляли 1:1 CH 3 CN/1-M водн. HCl (600 мкл). Полученный раствор анализировали непосредственно с помощью ЖХ-МС. Каждая аминокислота была дериватизирована как рацемическим, так и энантиочистым FDNP-аланамидом для сравнения. Абсолютная стереохимия была выведена по аналогии с L-триптофаном. Все продукты были >99% ее.

Структурное моделирование

Сообщалось о структуре TrpS из S. enterica (идентификатор PDB: 4HPX), в которой β-субъединица ( Se TrpB) находится в закрытом состоянии и содержит бензимидазол и сер- производное аминоакрилата в активном центре. 19 Эта структура служила шаблоном для модели гомологии TrpB дикого типа из T. maritima ( Tm TrpB, идентичность последовательности 58%), которая была сконструирована с использованием программы Swiss-Model. 18 Модель гомологии Tm TrpB была сопоставлена ​​с подлинной структурой Se TrpB с использованием PyMOL, что позволило картировать аминоакрилат и бензимидазол непосредственно в модели гомологии. Наконец, бензимидазол был заменен смоделированной структурой 4-цианоиндола, так что индольная часть 4-цианоиндола отображается на структуру бензимидазола.

Дополнительная информация

Щелкните здесь для просмотра. (1012K, pdf)

Эта работа финансировалась Институтом молекулярной инженерии Джейкобса для медицины (JIMEM) и Инновационной инициативой Ротенберга (RI 2 ) Калифорнийского технологического института. СЕБ была поддержана постдокторской стипендией Института устойчивого развития Резника, D.K.R. была поддержана постдокторской стипендией Рут Киршштейн NIH (F32GM117635) и М.С. был поддержан постдокторской стипендией Немецкой службы академических обменов (DAAD).

Дополнительная информация

Результаты библиотек мутагенеза с сайт-насыщением. Калибровочные кривые LCMS для . Данные ВЭЖХ для . Данные ВЭЖХ для и индола. Спектр ЯМР 4-цианотриптофана от .

ORCID:

Christina E. Boville: 0000-0002-2577-9343

David K. Romney: 0000-0003-0498-7597

Patrick J. Almhjell: 0000-0003-0977-841X

Микаэла Зибен: 0000-0002-4412-7148

Фрэнсис Х. Арнольд: 0000-0002-4027-364X

Примечания

Авторы заявляют о следующих конкурирующих финансовых интересах: Содержание этой статьи является предметом патентной заявки, поданной Калифорнийским технологическим институтом, и некоторые авторы имеют право на получение роялти от доходов, полученных от этого патента.

1. Смит Д.Т., Делост М.Д., Куреши Х., Ньярдарсон Дж.Т. Топ-200 фармацевтических продуктов по розничным продажам в 2016 году.

2. Эйгер ДЖ. Синтез неприродных/непротеиногенных α-аминокислот. В: Hughes AB, редактор. Аминокислоты, пептиды и белки в органической химии: происхождение и синтез аминокислот. Том. 1. Онлайн-библиотека Wiley; 2010. С. 495–526. [Google Scholar]

3. Brittain WDG, Cobb SL. Кросс-сочетания Негиши в синтезе аминокислот. Орг Биомол Хим. 2017;16(1):10–20. [PubMed] [Google Scholar]

4. Арнольд Л.Д., Калантар Т.Х., Ведерас Дж.К. Превращение серина в стереохимически чистые β-замещенные α-аминокислоты через β-лактоны. J Am Chem Soc. 1985;107:7105–7109. [Google Scholar]

5. Арнольд Л.Д., Дровер Дж., Ведерас Дж.К. Превращение сериновых β-лактонов в хиральные α-аминокислоты медьсодержащими литийорганическими и магнийорганическими реагентами. J Am Chem Soc. 1987;109(15):4649–4659. [Google Scholar]

6. Арнольд Л.Д., Мэй Р.Г., Ведерас Дж. К. Синтез оптически чистых α-аминокислот через соли α-амино-β-пропиолактона. J Am Chem Soc. 1988;110(7):2237–2241. [Google Scholar]

7. Таннер Д. Хиральные азиридины — их синтез и использование в стереоселективных превращениях. Angew Chem Int Ed. 1994;33(6):599–619. [Google Scholar]

8. Исикава Т. Азиридин-2-карбоксилаты: получение, раскрытие нуклеофильного кольца и расширение кольца. Гетероциклы. 2012;85(12):2837–2877. [Google Scholar]

9. Corr MJ, Smith D, Goss R. Единый доступ к l-5, 6-дигалотриптофанам и l-алкнилтриптофанам с использованием триптофансинтазы. Тетраэдр. 2016;72(46):7306–7310. [Google Scholar]

10. Smith DRM, Willemse T, Gkotsi DS, Schepens W, Maes BUW, Ballet S, Goss RJM. Первый однореакторный синтез 1-7-йодотриптофана из 7-йодоиндола и серина и улучшенный синтез других 1-7-галотриптофана. Орг. лат. 2014;16(10):2622–2625. [PubMed] [Академия Google]

11. Перни С., Хакетт Л., Госс Р.Дж., Симмонс М.Дж., Овертон Т.В. Оптимизация сконструированных биопленок Escherichia Coli для ферментативного биосинтеза l-галотриптофана. АМБ Экспресс. 2013;3(1):66. [Бесплатная статья PMC] [PubMed] [Google Scholar]

12. Winn M, Roy AD, Grüschow S, Parameswaran RS, Goss RJM. Удобный одностадийный синтез l-аминотриптофана и улучшенный синтез 5-фтортриптофана. Bioorg Med Chem Lett. 2008;18(16):4508–4510. [PubMed] [Google Scholar]

13. Goss RJM, Newill PLA. Удобный ферментативный синтез l-галотриптофана. хим. коммун. 2006;47:4924–4925. [PubMed] [Google Scholar]

14. Lee M, Phillips RS. Ферментативный синтез хлор-1-триптофана. Bioorg Med Chem Lett. 1992;2(12):1563–1564. [Google Scholar]

15. Hilaire MR, Ahmed IA, Lin C-W, Jo H, DeGrado WF, Gai F. Голубая флуоресцентная аминокислота для биологической спектроскопии и микроскопии. Proc Nat Acad Sci. 2017;114(23):6005–6009. [Бесплатная статья PMC] [PubMed] [Google Scholar]

16. Romney DK, Murciano-Calles J, Wehrmüller JE, Arnold FH. Раскрытие реакционной способности TrpB: общая биокаталитическая платформа для синтеза аналогов триптофана. J Am Chem Soc. 2017;139(31): 10769–10776. [Бесплатная статья PMC] [PubMed] [Google Scholar]

17. Murciano-Calles J, Romney DK, Brinkmann-Chen S, Buller AR, Arnold FH. Группа биокатализаторов TrpB, полученных из триптофансинтазы посредством переноса мутаций, имитирующих аллостерическую активацию. Angew Chem Int Ed. 2016;55(38):11577–11581. [Бесплатная статья PMC] [PubMed] [Google Scholar]

18. SWISS-MODEL доступна в Интернете по адресу https://swissmodel.expasy.org.

19. Никс Д., Иларио Э., Диркерс А., Нго Х., Борхардт Д., Нойбауэр Т.Дж., Фан Л., Мюллер Л.Дж., Данн М.Ф. Аллостерия и субстратный ченнелинг в биферментном комплексе триптофансинтазы: свидетельство двух конформаций субъединиц и четырех четвертичных состояний. Биохимия. 2013;52(37):6396–6411. [Бесплатная статья PMC] [PubMed] [Google Scholar]

20. Brückner H, Gah C. Высокоэффективное жидкостное хроматографическое разделение DL-аминокислот, дериватизированных хиральными вариантами реагента Сенгера. Journal of Chromatography A. 1991 [Google Scholar]

21. Buller AR, Brinkmann-Chen S, Romney DK, Herger M, Murciano-Calles J, Arnold FH. Направленная эволюция β-субъединицы триптофансинтазы для автономной функции повторяет аллостерическую активацию. Proc Nat Acad Sci. 2015;112(47):14599–14604. [Бесплатная статья PMC] [PubMed] [Google Scholar]

22. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. Ферментативная сборка молекул ДНК размером до нескольких сотен килобаз. Природные методы. 2009;6(5):343–345. [PubMed] [Google Scholar]

23. Kille S, Acevedo-Rocha CG, Parra LP, Zhang ZG, Opperman DJ, Reetz MT, Acevedo JP. Снижение избыточности кодонов и усилия по скринингу комбинаторных белковых библиотек, созданных путем мутагенеза с насыщением. ACS Synth Biol. 2013;2(2):83–9.2. [PubMed] [Google Scholar]

Химия гетероциклов


Химия гетероциклов

Соединения, классифицируемые как гетероциклические, вероятно, составляют самое большое и разнообразное семейство органических соединений. В конце концов, каждое карбоциклическое соединение, независимо от структуры и функциональности, в принципе может быть превращено в набор гетероциклических аналогов путем замены одного или нескольких атомов углерода в кольце другим элементом. Даже если мы ограничимся рассмотрением кислорода, азота и серы (самых распространенных гетероциклических элементов), вариантов и комбинаций такой замены множество.


Номенклатура

Разработка систематической номенклатурной системы для гетероциклических соединений представляла собой сложную задачу, решение которой не было единообразным. Многие гетероциклы, особенно амины, были идентифицированы раньше и получили тривиальные названия, которые до сих пор предпочтительны. Некоторые моноциклические соединения этого типа показаны на следующей диаграмме, где общее (тривиальное) название выделено жирным шрифтом, а систематическое название, основанное на системе Ганча-Видмана, дано под ним синим цветом. Правила использования этой системы будут даны позже. Для большинства учащихся изучение этих общеупотребительных названий обеспечит адекватный номенклатурный фон.

В легко запоминающейся, но ограниченной системе номенклатуры используется префикс элемента для гетероатома, за которым следует соответствующее название карбоцикла. Краткий список некоторых распространенных префиксов приведен в следующей таблице, в порядке возрастания приоритета справа налево. Примеры этой номенклатуры: этиленоксид = оксациклопропан, фуран = оксациклопента-2,4-диен, пиридин = азабензол и морфолин = 1-окса-4-азациклогексан.

Element oxygen sulfur selenium nitrogen phosphorous silicon boron
Valence II II II III III IV III
Префикс Окса Тиа Селена Аза Фосфа Сила 10131

Система Hantzsch-Widman обеспечивает более систематический метод именования гетероциклических соединений, который не зависит от предшествующих карбоциклических названий. В нем используется тот же префикс гетероатома, определенный выше (опуская окончательную букву «а»), за которым следует суффикс, обозначающий размер кольца и насыщенность. Как показано в следующей таблице, каждый суффикс состоит из корня размера кольца (синего цвета) и окончания, предназначенного для обозначения степени ненасыщенности кольца. В этом отношении важно признать, что насыщенный суффикс относится только к полностью насыщенные кольцевые системы , а суффикс ненасыщенный применяется к кольцам, содержащим максимальное количество некумулятивных двойных связей . Системы с меньшей степенью ненасыщенности требуют соответствующего префикса, такого как «дигидро» или «тетрагидро».

Ring Size 3 4 5 6 7 8 9 10
Suffix
  Unsaturated
  Saturated

ir ene
ir ane

et e
et ane

ol e
ol ane

in e
in ane

ep ine
ep ane

oc ine
oc ane

on ine
on ane

эк ине
ек ане

Несмотря на общую систематическую структуру системы Ханча-Видмана, в нее были включены несколько исключений и модификаций, чтобы учесть конфликты с предшествующим использованием. Некоторые примеры:

• Клемма "e" в суффиксе необязательна, хотя и рекомендуется.
• Насыщенные 3-, 4- и 5-членные гетероциклы азота должны использовать соответственно традиционные суффиксы «иридин», «этидин» и «олидин».
• Трехчленные гетероциклы с ненасыщенным азотом могут использовать традиционный суффикс «ирин».
• Последовательному использованию слов «этин» и «олин» в качестве суффиксов для 4- и 5-членных ненасыщенных гетероциклов препятствует их прежнее использование для азотистых гетероциклов аналогичного размера.
• Установленное использование оксина, азина и силана для других соединений или функций запрещает их использование для пирана, пиридина и силациклогексана соответственно.

Примеры этих правил номенклатуры выделены синим цветом как на предыдущей диаграмме, так и на приведенной ниже. Обратите внимание, что когда максимально ненасыщенное кольцо включает насыщенный атом, его положение может быть обозначено знаком «# 9».Префикс 0895 H ", чтобы избежать двусмысленности, как в пиране и пирроле выше и в нескольких примерах ниже. При нумерации кольца с более чем одним гетероатомом атом с наивысшим приоритетом имеет номер 1 и продолжается в направлении, которое дает следующему атому приоритета наименьший номер

Все предыдущие примеры были моноциклическими соединениями. Хорошо известны полициклические соединения, включающие одно или несколько гетероциклических колец. Некоторые из них показаны на следующей диаграмме. Как и прежде, общие названия выделены черным цветом, а систематические названия — синим. Два хинолина иллюстрируют еще один нюанс номенклатуры гетероциклов. Таким образом, расположение конденсированного кольца может быть указано строчной буквой, которая обозначает край гетероциклического кольца, участвующего в слиянии, как показано пиридиновым кольцом в зеленой заштрихованной рамке.

Гетероциклические кольца встречаются во многих природных соединениях. В частности, они составляют основные структуры моно- и полисахаридов, а также четыре основания ДНК, которые устанавливают генетический код. При нажатии на приведенную выше диаграмму будут отображены некоторые другие примеры гетероциклических натуральных продуктов.

Подготовка и реакции

Кольца трехчленные

Оксираны (эпоксиды) являются наиболее часто встречающимися трехчленными гетероциклами. Эпоксиды легко получают реакцией алкенов с надкислотами, обычно с хорошей стереоспецифичностью. Из-за большой угловой деформации трехчленного кольца эпоксиды более реакционноспособны, чем ненапряженные эфиры. Реакции присоединения, протекающие посредством электрофильного или нуклеофильного раскрытия кольца, составляют наиболее общий класс реакций. Пример 1 на следующей диаграмме показывает одно такое превращение, которое представляет интерес из-за последующего превращения промежуточного продукта присоединения в соответствующий тииран. Начальное раскрытие кольца стереоэлектронно направлено трансдиаксиальным образом, промежуточное соединение релаксирует до диэкваториального конформера перед циклизацией до промежуточного соединения 1,3-оксатиолана.
Другие примеры показывают аналогичные реакции присоединения к тииранам и азиридинам. Катализируемые кислотой присоединения в примерах 2 и 3 иллюстрируют влияние заместителей на региоселективность присоединения. Пример 2 отражает характер S N 2 атаки нуклеофила (хлорид-анион) на протонированный азиридин (местом присоединения является менее замещенный углерод). Фенильный заместитель в примере 3 служит для стабилизации проявляющегося карбокатиона до такой степени, что S N 1 Селективность реализована. Восстановление тииранов до алкенов реакцией с фосфитными эфирами (пример 6) является высокостереоспецифическим и, как полагают, происходит за счет начального связывания фосфора с серой.

При нажатии на приведенную выше диаграмму будут отображены четыре дополнительных примера реакционной способности или промежуточного состояния трехчленного гетероцикла. Примеры 7 и 8 представляют собой термические реакции, в которых важными факторами являются как гетероатом, так и напряженный цикл. Промежуточное соединение α-лактона, показанное при сольволизе оптически активной 2-бромпропановой кислоты (пример 9) объясняет как кинетику 1-го порядка этой реакции, так и сохранение конфигурации в продукте. Обратите внимание, что две инверсии конфигурации в C-2 приводят к общему сохранению. Задокументировано множество примеров внутримолекулярных взаимодействий, таких как пример 10.
Была отмечена интересная региоселективность во внутримолекулярных реакциях раскрытия цикла дизамещенных эпоксидов, имеющих боковой γ-гидроксизаместитель. Как показано ниже, реакции, катализируемые кислотой и основанием, обычно протекают путем 5-экзозамещения (реакция 1) с образованием тетрагидрофуранового продукта. Однако, если оксиран имеет ненасыщенный заместитель (винил или фенил), катализируемое кислотой раскрытие происходит по аллильному (или бензиловому) углероду (реакция 2) по 6-эндо-модулю. π-электронная система заместителя способствует развитию положительного заряда на соседнем оксирановом углероде, направляя нуклеофильную атаку на этот сайт.


Четырехчленные кольца

      Подготовка
Несколько способов получения четырехчленных гетероциклических соединений показаны на следующей диаграмме. Простая процедура обработки 3-галогенспирта, тиола или амина основанием обычно эффективна, но выходы часто посредственны. Димеризация и элиминация являются обычными побочными реакциями, и в реакции могут конкурировать другие функции. В случае примера 1 циклизация в оксиран конкурирует с образованием тиетана, но преобладает большая нуклеофильность серы, особенно при использовании слабого основания. В примере 2 возможно образование как азиридина, так и азетидина, но наблюдается только первый. Это хороший пример кинетического преимущества образования трехчленного кольца. Пример 4 демонстрирует, что этот подход к образованию азетидина хорошо работает в отсутствие конкуренции. Действительно, исключительный выход этого продукта объясняется заменой гем-диметила, Эффект Торпа-Ингольда , который, как полагают, благоприятствует конформациям спиральной цепи. Относительно жесткая конфигурация подложки в примере 3 способствует образованию оксетана и предотвращает возникновение циклизации оксирана. Наконец, фотоциклизация Патерно-Бучи в примерах 5 и 6 особенно подходит для образования оксетана.

      Реакции
Реакции четырехчленных гетероциклов также показывают влияние деформации кольца. Некоторые примеры приведены на следующей диаграмме. Кислотный катализ является общей чертой многих реакций раскрытия цикла, как показано в примерах 1, 2 и 3а. В тиетановой реакции (2) сера подвергается электрофильному хлорированию с образованием промежуточного соединения хлорсульфония с последующим замещением иона хлорида с раскрытием цикла. Сильные нуклеофилы также откроют напряженный эфир, как показывает реакция 3б. Реакции расщепления β-лактонов могут происходить либо путем катализируемого кислотой ацильного обмена, как в 4a, либо путем разрыва алкил-O нуклеофилами, как в 4b. Пример 5 представляет собой интересный случай внутримолекулярной перегруппировки в ортоэфир. Наконец, β-лактамное расщепление пенициллина G (реакция 6) свидетельствует о повышенной ацилирующей реакционной способности этой конденсированной кольцевой системы. Большинство амидов являются чрезвычайно нереакционноспособными реагентами для ацилирования благодаря стабилизации p-π-резонансом. Такая делокализация электронных пар уменьшается в пенициллинах, оставляя азот с пирамидальной конфигурацией и карбонильной функцией, более реактивной по отношению к нуклеофилам.


Кольца пятичленные

      Подготовка
Коммерческое получение фурана происходит за счет альдегида, фурфурола, который, в свою очередь, образуется из содержащего пентозу сырья, такого как кукурузные початки, как показано в верхнем уравнении ниже. Аналогичные препараты пиррола и тиофена изображены в уравнениях второй строки. Уравнение 1 в третьем ряду иллюстрирует общее получение замещенных фуранов, пирролов и тиофенов из 1,4-дикарбонильных соединений, известное как синтез Паала-Кнорра. Было разработано много других способов, ведущих к замещенным гетероциклам такого типа. Два из них показаны в реакциях 2 и 3. Фуран восстанавливается до тетрагидрофурана путем гидрирования, катализируемого палладием. Этот циклический эфир является не только ценным растворителем, но и легко превращается в 1,4-дигалобутан или 4-галогеналкилсульфонаты, которые можно использовать для получения пирролидина и тиолана.
Реакции диполярного циклоприсоединения часто приводят к более сложным пятичленным гетероциклам.

Индол, вероятно, является наиболее важным гетероциклом с конденсированным кольцом в этом классе. При нажатии на приведенную выше диаграмму будут отображены три примера синтеза индола. Первый протекает путем электрофильного замещения активированного азотом бензольного кольца. Второй предположительно происходит за счет образования дианионной формы, в которой звено ArCH 2 (–) связано с дезактивированной карбонильной группой. Наконец, синтез индола Фишера представляет собой замечательную последовательность реакций таутомерии, сигматропной перегруппировки, нуклеофильного присоединения и отщепления, происходящих после образования фенилгидразона. Это интересное превращение включает окисление двух атомов углерода и восстановление одного углерода и обоих атомов азота.

      Реакции
Химическая реакционная способность насыщенных представителей этого класса гетероциклов: тетрагидрофурана, тиолана и пирролидина подобна реакционной способности ациклических эфиров, сульфидов и 2º-аминов, и здесь описываться не будет. 1,3-Диоксоланы и дитиоланы представляют собой циклические ацетали и тиоацетали. Эти звенья обычно используются в качестве защитных групп для альдегидов и кетонов и могут гидролизоваться под действием водной кислоты.
Нашего внимания требуют «ароматические» ненасыщенные соединения, фуран, тиофен и пиррол. В каждом случае гетероатом имеет по крайней мере одну пару несвязывающих электронов, которые могут объединяться с четырьмя π-электронами двойных связей с образованием аннулена, имеющего ароматический секстет электронов. Это иллюстрируется описанием резонанса в верхней части следующей диаграммы. Гетероатом Y становится sp 2 -гибридизированным и приобретает положительный заряд, поскольку его электронная пара делокализована вокруг кольца. Легко наблюдаемым следствием этой делокализации является изменение дипольного момента по сравнению с аналогичными насыщенными гетероциклами, которые все имеют сильные диполи с гетероатомом на отрицательном конце. Как и ожидалось, ароматические гетероциклы имеют гораздо меньшие дипольные моменты, а в случае пиррола — большой диполь в противоположном направлении. Важной характеристикой ароматичности является повышенная термодинамическая стабильность, и это обычно демонстрируется измерениями относительной теплоты гидрирования или теплоты сгорания. По этому стандарту три рассматриваемых ароматических гетероцикла стабилизируются, но в меньшей степени, чем бензол.
Дополнительные доказательства ароматического характера пиррола обнаруживаются в его исключительно слабой основности (pK a ca. 0) и сильной кислотности (pK a = 15) для 2º-амина. Соответствующие значения для насыщенного пирролидина амина: основность 11,2 и кислотность 32.

Еще одной характеристикой ароматических систем, имеющей особое значение для химиков, является характер их реакционной способности с электрофильными реагентами. В то время как простые циклоалкены обычно дают реакции присоединения, ароматические соединения имеют тенденцию реагировать путем замещения. Как отмечено для бензола и его производных, эти замещения происходят путем первоначального добавления электрофила, за которым следует потеря протона из «ониевого» промежуточного соединения для регенерации ароматического кольца. Все ароматические пятичленные гетероциклы подвергаются электрофильному замещению с общим порядком реакционной способности: пиррол >> фуран > тиофен > бензол. Некоторые примеры приведены на следующей диаграмме. Условия реакции ясно показывают большую реакционную способность фурана по сравнению с тиофеном. Все эти ароматические гетероциклы энергично реагируют с хлором и бромом, часто образуя вместе с полимерами полигалогенированные продукты. Об исключительной реакционной способности пиррола свидетельствует его реакция с йодом (нижнее левое уравнение) и образование 2-ацетилпиррола при простом нагревании его с уксусным ангидридом (без катализатора).

Существует явное предпочтение замещения в положении 2 (α) кольца, особенно для фурана и тиофена. Реакции пиррола требуют тщательной оценки, так как N-протонирование разрушает его ароматический характер. Действительно, N-замещение этого 2º-амина часто проводят перед последующими реакциями. Например, пиррол реагирует с уксусным ангидридом или ацетилхлоридом и триэтиламином с образованием N-ацетилпиррола. Следовательно, региоселективность замещения пиррола является переменной, как показано в правом нижнем уравнении.
Объяснение общей α-селективности этих реакций замещения очевидно из механизма, описанного ниже. Интермедиат, образованный электрофильной атакой на С-2, стабилизируется за счет делокализации заряда в большей степени, чем интермедиат атаки С-3. Из постулата Хаммонда мы можем заключить, что энергия активации замещения в первом положении меньше, чем при втором замещении.

Функциональные заместители влияют на реакции замещения этих гетероциклов примерно так же, как и в случае бензола. В самом деле, если понять орто-пара- и мета-направляющий характер этих заместителей, нетрудно предсказать их направляющее влияние на замещение гетероциклического кольца. На следующей диаграмме показаны семь таких реакций. Реакции 1 и 2 представляют собой 3-замещенные тиофены, первая - электронодонорным заместителем, а вторая - электроноакцепторной группой. Третья реакция имеет два заместителя разного типа во 2-м и 5-м положениях. Наконец, примеры с 4 по 7 иллюстрируют реакции 1,2- и 1,3-оксазола, тиазола и диазола. Обратите внимание, что основность sp 2 -гибридизованный азот в диазолах более чем в миллион раз больше, чем у кажущегося sp 3 -гибридизованного азота, электронная пара которого является частью ароматического секстета электронов.

Другие возможные реакции предполагаются структурными особенностями этих гетероциклов. Например, фуран можно рассматривать как эфир енола, а пиррол — как енамин. Известно, что такие функциональные группы подвергаются катализируемому кислотой гидролизу до карбонильных соединений и спиртов или аминов. Поскольку эти соединения также представляют собой диены, замещенные гетероатомом, мы можем ожидать реакции циклоприсоединения Дильса-Альдера с соответствующими диенофилами. Эти возможности будут проиллюстрированы выше, нажав на диаграмму. Как отмечено в верхнем примере, фураны действительно могут гидролизоваться до 1,4-дикарбонильных соединений, но пирролы и тиофены ведут себя по-разному. Вторые два примера, показанные в середине, демонстрируют типичные реакции фурана и пиррола с сильным диенофильным малеиновым ангидридом. Первый участвует в реакции циклоприсоединения; однако пиррол просто подвергается электрофильному замещению по С-2. Тиофен не легко реагирует с этим диенофилом.
Нижняя линия новой диаграммы иллюстрирует заметное влияние дополнительных азотных звеньев на гидролиз ряда N-ацетилазолов в воде при 25 ºC и pH=7. Соединение пиррола слева практически нереакционноспособно, как и ожидалось для амида, но дополнительные атомы азота заметно увеличивают скорость гидролиза. Этот эффект был использован на практике при применении реагента ацилирования 1,1'-карбонилдиимидазола (реактив Штааба).

Еще одна грань химии гетероциклов была раскрыта в ходе исследований действия тиамина (следующая диаграмма). Как производное пирофосфата, тиамин является коферментом для нескольких биохимических реакций, особенно декарбоксилирования пировиноградной кислоты до ацетальдегида и ацетоина. Ранние исследователи предположили, что промежуточным звеном в этих реакциях были «активные альдегиды» или ацилкарбанионы. Было сделано много предложений, некоторые из которых касались аминопиримидинового фрагмента, а другие - гидролизных производных тиазольного кольца с открытым кольцом, но ни одно из них не было удовлетворительным. Эта загадка была решена, когда Р. Бреслоу (Колумбия) обнаружил, что водород С-2 солей тиазолия оказался неожиданно кислым (pK а ок . 13), образуя относительно стабильное илидное сопряженное основание. Как показано, это объясняет легкое декарбоксилирование тиазолий-2-карбоновых кислот и дейтерийный обмен при С-2 в нейтральной тяжелой воде.
Соответствующие соли тиазолия катализируют превращение альдегидов в ацилоины почти так же, как цианид-ион катализирует образование бензоина из бензальдегида, бензоиновую конденсацию . Щелкнув по диаграмме, на новом дисплее отобразятся механизмы этих двух реакций. Обратите внимание, что в обоих случаях 9Образуется ацил-анион 0785, эквивалентный , который затем присоединяется к карбонильной группе ожидаемым образом. Конденсация бензоина ограничена ароматическими альдегидами, но использование тиазолиевых катализаторов оказалось широко эффективным для алифатических и ароматических альдегидов. Этот подход к ацилоинам использует более мягкие условия, чем восстановление сложных эфиров до эндиоловых промежуточных соединений под действием металлического натрия.

Наиболее важной системой конденсированных колец, относящейся к этим гетероциклам, является индол. Некоторые реакции электрофильного замещения индола показаны на следующей диаграмме. Независимо от того, замещен азот индола или нет, предпочтительным местом атаки является С-3 гетероциклического кольца. Связывание электрофила в этом положении позволяет стабилизировать ониевое промежуточное соединение азотом без нарушения ароматичности бензола.


Шестичленные кольца

      Свойства
Химическая реакционная способность насыщенных представителей этого класса гетероциклов: тетрагидропирана, тиана и пиперидина подобна реакционной способности ациклических эфиров, сульфидов и 2º-аминов и здесь описываться не будет. 1,3-Диоксаны и дитианы являются циклическими ацеталями и тиоацеталями. Эти звенья обычно используются в качестве защитных групп для альдегидов и кетонов, а также синтетических промежуточных продуктов и могут гидролизоваться под действием водной кислоты. Реакционная способность частично ненасыщенных соединений зависит от соотношения двойной связи и гетероатома ( например . 3,4-дигидро-2Н-пиран представляет собой эфир енола).
Полностью ненасыщенные шестичленные азотсодержащие гетероциклы, такие как пиридин, пиразин, пиримидин и пиридазин, имеют стабильные ароматические кольца. Аналоги кислорода и серы обязательно заряжены положительно, как в случае тетрафторбората 2,4,6-трифенилпирилия.

Согласно измерениям теплоты сгорания, энергия ароматической стабилизации пиридина составляет 21 ккал/моль. Описание резонанса, приведенное в верхней части следующей диаграммы, включает структуры с разделенным зарядом, которые обычно не рассматриваются для бензола. Большая электроотрицательность азота (относительно углерода) предполагает, что такие канонические формы могут вносить значительный вклад. Действительно, больший дипольный момент пиридина по сравнению с пиперидином подтверждает эту точку зрения. Пиридин и его производные являются слабыми основаниями, отражающими sp 2 гибридизация азота. Из показанных здесь полярных канонических форм должно быть очевидно, что электронодонорные заместители увеличивают основность пиридина и что заместители во 2-м и 4-м положениях будут влиять на эту основность больше, чем эквивалентный 3-заместитель. Значения pK и , приведенные в таблице, иллюстрируют некоторые из этих эффектов заместителей. Метилзамещенные производные имеют общие названия пиколин (метилпиридины), лутидин (диметилпиридины) и коллидин (триметилпиридины). Влияние 2-заместителей сложное, состоит из стерических затруднений и электростатических составляющих. 4-Диметиламинопиридин является полезным катализатором реакций ацилирования, проводимых в пиридине в качестве растворителя. На первый взгляд сп 3 гибридизованный азот может показаться более сильным основанием, но следует помнить, что N,N-диметиланилин имеет pK a немного ниже, чем у самого пиридина. Следовательно, азот кольца sp 2 является местом, в котором происходит протонирование.

Диазины пиразин, пиримидин и пиридазин являются более слабыми основаниями, чем пиридин, из-за индукционного эффекта второго азота. Однако порядок базовой силы неожиданный. Рассмотрение полярных компонентов помогает объяснить разницу между пиразином и пиримидином, но основность пиридазина кажется аномальной. Было высказано предположение, что отталкивание электронных пар с участием вицинальных атомов азота дестабилизирует нейтральное основание по сравнению с сопряженной с ним кислотой.

      Электрофильное замещение пиридина
Пиридин является скромным основанием (pK a = 5,2). Поскольку основная неподеленная электронная пара не является частью ароматического секстета, как в пирроле, пиридиниевые соединения, образующиеся в результате N-замещения, сохраняют ароматичность пиридина. Как показано ниже, продукты N-алкилирования и N-ацилирования могут быть получены в виде стабильных кристаллических твердых веществ в отсутствие воды или других реакционноспособных нуклеофилов. Соли N-ацила могут служить агентами переноса ацила для получения сложных эфиров и амидов. Из-за стабильности катиона пиридиния его использовали в качестве замедлителя в комплексах с рядом реакционноспособных неорганических соединений. Несколько примеров этих стабильных и простых в обращении реагентов показаны внизу диаграммы. Поли(фтороводородная) соль является удобным источником HF для присоединения к алкенам и превращения спиртов в алкилфториды, хлорхромат пиридиния (PCC) и родственный ему дихроматный аналог являются универсальными окислителями, а трибромидная соль является удобным источником брома. Точно так же с реакционноспособными соединениями триоксида серы и диборана удобно и безопасно обращаться как с пиридиновыми комплексами.
Аминоксидные производные 3º-аминов и пиридина легко получают окислением надкислотами или пероксидами, как показано в уравнении вверху справа. Восстановление до амина обычно достигается обработкой цинком (или другими химически активными металлами) в разбавленной кислоте.

Исходя из предыдущего резонансного описания пиридина, мы ожидаем, что этот ароматический амин гораздо менее легко подвергается реакциям электрофильного замещения, чем бензол. Кроме того, как показано выше, нажав на диаграмму, электрофильные реагенты и катализаторы, используемые в этих реакциях, координируются с электронной парой азота, усиливая положительный заряд в положениях 2, 4 и 6 пиридинового кольца. Слева показаны три примера экстремальных условий, необходимых для электрофильного замещения. Заместители, которые блокируют электрофильную координацию с азотом или снижают основность азота, облегчают замещение, как показано в примерах, заштрихованных синим цветом в правом нижнем углу, но замещение по С-3 остается доминирующим. Активирующие заместители в других местах также влияют на легкость и региоселективность замещения. Щелкнув по диаграмме второй раз, слева отобразятся три примера. Аминовый заместитель в верхнем регистре направляет замещение к С-2, но более слабый электронодонорный метильный заместитель в среднем примере не может преодолеть тенденцию к 3-замещению. Гидроксильные заместители в C-2 и C-4 таутомеризуются в пиридоны, как показано для 2-изомера внизу слева.
N-оксид пиридина претерпевает некоторые электрофильные замещения по С-4 и другие по С-3. Координационная ковалентная связь N–O может оказывать двухтактное влияние, как показано в двух примерах справа. Хотя положительно заряженный азот сам по себе оказывает сильное дезактивирующее влияние, отрицательно заряженный кислород может вносить электронную плотность в атомы C-2, C-4 и C-6 за счет π-связи с кольцевым азотом. Это контролирующий фактор относительно легкого нитрования по С-4. Однако, если кислород связан с электрофилом, таким как SO 3 , образующийся ион пиридиния будет реагировать вяло и преимущественно при С-3.

Гетероциклы хинолина и изохинолина с конденсированным кольцом предоставляют дополнительные доказательства стабильности пиридинового кольца. Интенсивное перманганатное окисление хинолина приводит к преимущественной атаке на бензольное кольцо; изохинолин дает продукты расщепления обоих колец. Обратите внимание, что нафталин окисляется до фталевой кислоты аналогичным образом. Напротив, гетероциклическое кольцо в обоих соединениях преимущественно подвергается каталитическому гидрированию с образованием тетрагидропродуктов. Электрофильное нитрование, галогенирование и сульфирование обычно происходят по C-5 и C-8 бензольного кольца, что согласуется с предыдущим описанием подобных пиридиновых реакций и кинетически предпочтительным замещением нафталина по C-1 (α), а не C- 2 (β).

      Другие реакции пиридина

Благодаря азоту в кольце пиридиновые соединения легче вступают в реакции нуклеофильного замещения, чем эквивалентные производные бензола. На следующей диаграмме реакция 1 иллюстрирует замещение 2-хлорзаместителя анионом этоксида. Механизму присоединения-отщепления, показанному для этой реакции, помогает способность азота поддерживать отрицательный заряд. Аналогичное промежуточное соединение может быть записано для замены 4-галогенпиридина, но замена в положении 3 запрещена из-за невозможности создания промежуточного соединения такого типа. Два аминирования Чичибабина в реакциях 2 и 3 примечательны тем, что уходящим анионом является гидрид (или его эквивалент). В ходе этих реакций часто выделяется водород. В соответствии с этим механизмом хинолин аминирован как по С-2, так и по С-4.
Присоединение сильных нуклеофилов к N-оксидным производным пиридина происходит быстрее, чем к самому пиридину, о чем свидетельствуют реакции 4 и 5. Дигидропиридиновый промежуточный продукт легко теряет воду или ее эквивалент за счет отщепления заместителя –OM от азота.

При нажатии на приведенную выше диаграмму будут отображены пять дополнительных примеров реакций оснований или нуклеофилов с замещенным пиридином. Поскольку пиридиновое кольцо (и, в большей степени, N-оксидное кольцо) может нести отрицательный заряд, алкильные заместители во 2-м и 4-м положениях активируются таким же образом, как карбонильная группа. Реакции 6 и 7 показывают реакции алкилирования и конденсации, возникающие в результате этой активации. Реакция 8 является примером образования N-алкилпиридона путем присоединения гидроксида к катиону N-алкилпиридиния с последующим мягким окислением. Восстановление березы превращает пиридины в дигидропиридины, которые представляют собой бис-енамины и могут гидролизоваться до 1,5-дикарбонильных соединений. Соли пиридиния подвергаются переносу одного электрона с образованием исключительно стабильных свободных радикалов. Пример, показанный в реакции 9представляет собой стабильную (в отсутствие кислорода) жидкость зеленого цвета, пригодную для перегонки. Хотя 3-галогенпиридины не вступают в реакции замещения присоединения-отщепления, как их 2- и 4-изомеры, сильное основание амида натрия вызывает аминирование посредством пиридинового промежуточного соединения. Это иллюстрируется реакцией 10. Интересно, что 3-пиридин образуется в большей степени, чем 2-пиридин. Последний образуется, если С-4 занят алкильным заместителем. Промежуточный пиридин подобен бензину.

Некоторые полициклические гетероциклы

Гетероциклические структуры встречаются во многих натуральных продуктах. Примеры некоторых соединений азота, известных как алкалоиды из-за их основных свойств, приведены в главе, посвященной аминам. Некоторые другие примеры показаны на следующей диаграмме. Камптотецин представляет собой хинолиновый алкалоид, который ингибирует ДНК-фермент топоизомеразу I. Резерпин представляет собой индольный алкалоид, который используется для контроля высокого кровяного давления и лечения психотического поведения. Аймалин и стрихнин также являются индольными алкалоидами, первый из которых является антиаритмическим средством, а второй — чрезвычайно токсичным пестицидом. Нейротоксины сакситоксин и тетродотоксин оба имеют морское происхождение и характеризуются фрагментами гуанидиния. Афлатоксин В 1 представляет собой неазотистое канцерогенное соединение, продуцируемое грибком Aspergillus.

Порфирин представляет собой важный циклический тетрапиррол, являющийся основной структурой гема и хлорофилла. Эти структуры будут нарисованы выше, нажав на диаграмму.

Производные простого гетероцикла с конденсированным кольцом пурина составляют особенно важное и многочисленное семейство натуральных продуктов. Аминосоединения аденин и гуанин являются двумя комплементарными основаниями, которые являются важными компонентами ДНК. Структуры этих соединений показаны на следующей диаграмме. Ксантин и мочевая кислота являются продуктами метаболического окисления пуринов. Мочевая кислота обычно выделяется с мочой; избыточное накопление мочевой кислоты в сыворотке может привести к артритному состоянию, известному как подагра.

Примеры распространенных метилированных пуринов будут приведены выше, нажав на диаграмму. Кофеин, наиболее известный из них, представляет собой горький кристаллический алкалоид. Он содержится в различных количествах вместе с дополнительными алкалоидами, такими как сердечные стимуляторы теофиллин и теобромин, в бобах, листьях и плодах некоторых растений. Напитки, содержащие кофеин, такие как кофе, чай и некоторые безалкогольные напитки, возможно, являются наиболее широко потребляемыми напитками в мире. Кофеин является стимулятором центральной нервной системы, предотвращает сонливость и восстанавливает бдительность. Параксантеин является основным метаболитом кофеина в организме.

Гетероциклы серы встречаются в природе, но в меньшей степени, чем их азотные и кислородные аналоги. Два члена комплекса витаминов группы В, биотин и тиамин, включают такие гетероциклические фрагменты. Они показаны вместе с другими гетероциклическими витаминами группы В на следующей диаграмме.

Terthienyl представляет собой интересный тример тиофена, обнаруженный в корнях бархатцев, где он обеспечивает немицидную активность. Исследования показали, что УФ-облучение тертиенила вызывает общую фототоксичность для многих организмов. Полимеры, включающие тиофеновые звенья и сплавленные системы, такие как дитиенотиофен, обладают интересными электромагнитными свойствами и перспективны в качестве органических металлоподобных проводников и фотогальванических материалов. Комплекс с переносом заряда, образованный тетратиофульваленом и тетрацианохинодиметаном, имеет одну из самых высоких электропроводностей, зарегистрированных для твердого органического вещества.


Learn more

Корзина
товаров: 0 на сумму 0.00 руб.

Стеллажи Тележки Шкафы Сейфы Разное

Просмотр галереи

 

Новости

Сделаем красиво и недорого

На протяжении нескольких лет работы в области складского хозяйства нашими специалистами было оснащено немало складов...

08.11.2018

Далее

 

С Новым годом!

Коллектив нашей компании поздравляет всех с Наступающим Новым 2012 годом!

02.12.2018

Далее

 

Работа с клиентом

Одним из приоритетов компании является сервис обслуживания клиентов. На примере мы расскажем...

01.11.2018

Далее

 

Все новости
 


 

© 2007-2019. Все права защищены
При использовании материалов, ссылка обязательна.
стеллажи от СТ-Интерьер (г.Москва) – изготовление металлических стеллажей.
Электронная почта: [email protected]
Карта сайта